![]() |
|||||
![]() |
![]() |
Noble Research Institute | VIGS Database | |||
VIGS Phenomics and Functional Genomics Database | |||||
![]() |
Phenotype Description | |||
---|---|---|---|
Crinkled top leaves, reduction in plant height, loss of apical dominance (more branching coupled with growth of axillary buds) | |||
Annotation | |||
Solyc05g006400.2.1;genomic_reference:SL2.50ch05 gene_region:1038916-1043766 transcript_region:SL2.50ch05:1038916..1043766- functional_description:"Genomic DNA chromosome 5 P1 clone MBG8 (AHRD V1 ***- Q9FFU3_ARATH)" | |||
ref|XP_009605574.1|;PREDICTED: uncharacterized protein LOC104100114 [Nicotiana tomentosiformis] | |||
NbS00002497g0011.1;protein AED:0.22 eAED:0.24 QI:0|0.71|0.5|1|0.85|0.75|8|427|619; (*TAIR) AT1G70160.1 (e_value=0.0) | Symbols: | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27020.1); Has 108 Blast hits to 108 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). | chr1:26420159-26422345 FORWARD LENGTH=523;; (*ITAG) Solyc05g006400.2.1 (e_value=0.0) genomic_reference:SL2.40ch05 gene_region:1038916-1043766 transcript_region:SL2.40ch05:1038916..1043766- functional_description:"Genomic DNA chromosome 5 P1 clone MBG8 (AHRD V1 ***- Q9FFU3_ARATH)"; | |||
AT1G70160.1;| Symbols: | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27020.1); Has 108 Blast hits to 108 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). | chr1:26420159-26422345 FORWARD LENGTH=523 | |||
GO ID (Nr annotation) | |||
GO ID (Arabidopsis annotation) | |||
GO:0005576 GO:0004867 GO:0010951 | |||
GO ID (Tomato annotation) | |||
GO ID (Niben annotation) | |||
GO:0005764 GO:0005783 GO:0005794 GO:0005856 GO:0005901 GO:0009986 GO:0016235 GO:0016324 GO:0030426 GO:0031012 GO:0031965 GO:0031966 GO:0033596 GO:0034366 GO:0042584 GO:0043025 GO:0048471 GO:0070062 GO:0072562 GO:0097418 GO:0097440 GO:0003676 GO:0004522 GO:0005096 GO:0005509 GO:0005544 GO:0008201 GO:0016887 GO:0019902 GO:0030246 GO:0031267 GO:0031625 GO:0035374 GO:0042803 GO:0046982 GO:0047485 GO:0048306 GO:0051059 GO:0051787 GO:0071889 GO:0001666 GO:0001774 GO:0001843 GO:0006606 GO:0007219 GO:0007283 GO:0007507 GO:0007568 GO:0008284 GO:0009416 GO:0009611 GO:0009615 GO:0014065 GO:0014067 GO:0016239 GO:0030100 GO:0030178 GO:0030855 GO:0031018 GO:0032007 GO:0032088 GO:0032286 GO:0032436 GO:0032463 GO:0032760 GO:0032869 GO:0035864 GO:0043407 GO:0043491 GO:0043547 GO:0044849 GO:0044861 GO:0045429 GO:0045597 GO:0045792 GO:0045944 GO:0046323 GO:0046627 GO:0048009 GO:0048812 GO:0050680 GO:0050821 GO:0050918 GO:0051056 GO:0051092 GO:0051131 GO:0051260 GO:0051291 GO:0051726 GO:0051788 GO:0051898 GO:0061077 GO:0061518 GO:0071363 GO:0090502 GO:0097193 GO:1900221 GO:1901216 GO:1902004 GO:1902230 GO:1902430 GO:1902847 GO:1902949 GO:1902998 GO:2000060 GO:2000483 GO:2001244 | |||
Sequence | |||
>NbTI01A04CCCCAAAGTAATTTGGAACTCAAGCCTCTTCCTTCAATGGAACCCTAAATCAATTCAGCAGAATCCCCAAAAATCCCAATCATCAACGACAAACTGCAAA |
2-1:1A1-1D12 [6-20-12]//1A4-2.JPG |